Review




Structured Review

Santa Cruz Biotechnology e2f2
Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, <t>E2F2,</t> FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, <t>E2F2,</t> and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.
E2f2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2f2/product/Santa Cruz Biotechnology
Average 93 stars, based on 161 article reviews
e2f2 - by Bioz Stars, 2026-05
93/100 stars

Images

1) Product Images from "Novel Therapeutic Strategy for Renal Cell Carcinoma: Niclosamide Enhances Sunitinib Efficacy via DNA Repair and Cell Cycle Pathways"

Article Title: Novel Therapeutic Strategy for Renal Cell Carcinoma: Niclosamide Enhances Sunitinib Efficacy via DNA Repair and Cell Cycle Pathways

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms262210922

Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, E2F2, FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, E2F2, and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.
Figure Legend Snippet: Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, E2F2, FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, E2F2, and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.

Techniques Used: Expressing, Western Blot, Control



Similar Products

86
Genechem e2f2
E2f2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2f2/product/Genechem
Average 86 stars, based on 1 article reviews
e2f2 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

93
Novus Biologicals mouse anti e2f2 antibody
Mouse Anti E2f2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti e2f2 antibody/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
mouse anti e2f2 antibody - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Novus Biologicals anti e2f2
Anti E2f2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti e2f2/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
anti e2f2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology e2f2
Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, <t>E2F2,</t> FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, <t>E2F2,</t> and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.
E2f2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2f2/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
e2f2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

86
Shanghai Genechem Ltd e2f2 overexpression
Expression and prognostic analysis of <t>E2F2</t> in SOCs. (A) Expression of E2F2 was significantly upregulated in SOC tissues. (B) E2F2 expression was increased in the grade 2/3 group compared with the grade 1 group. (C–H) SOC patients with high expression of E2F2 had poor OS and PFS. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
E2f2 Overexpression, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2f2 overexpression/product/Shanghai Genechem Ltd
Average 86 stars, based on 1 article reviews
e2f2 overexpression - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

93
Addgene inc e2f2
a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, <t>E2F2</t> or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.
E2f2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e2f2/product/Addgene inc
Average 93 stars, based on 1 article reviews
e2f2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc pcmvha e2f2
a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, <t>E2F2</t> or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.
Pcmvha E2f2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmvha e2f2/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcmvha e2f2 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

Image Search Results


Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, E2F2, FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, E2F2, and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.

Journal: International Journal of Molecular Sciences

Article Title: Novel Therapeutic Strategy for Renal Cell Carcinoma: Niclosamide Enhances Sunitinib Efficacy via DNA Repair and Cell Cycle Pathways

doi: 10.3390/ijms262210922

Figure Lengend Snippet: Correlation between experimental and clinical expression of niclosamide-regulated genes. ( A ) BRIP1, E2F2, FANCA, DNA2, and TTK mRNA expression levels in normal tissue (NT) and primary tumor tissue (TP) from TCGA-KIRC dataset. ( B ) A-498 and ACHN cells were treated with 2.5 µM sunitinib, 1 µM niclosamide, or their combination, for 48 h. Protein expression of BRIP, E2F2, and FANCA was detected by Western blot; GAPDH was a loading control. Representative blots from n = 3 independent experiments are shown. Densitometric quantification of γ-H2AX relative to GAPDH is presented as mean ± SD (n = 3). Statistical significance was determined by one-way ANOVA with post hoc tests. (* p < 0.05 compared to control). D, DMSO; S, sunitinib; N, niclosamide; C, combination.

Article Snippet: The membranes were blocked and subsequently incubated overnight at 4 °C with specific primary antibodies against BRIP1 (Cell Signaling Technology), E2F2 (Santa Cruz Biotechnology, Inc., Dallas, TX, USA), FANCA (Cell Signaling Technology), γH2AX (Ser139; Cell Signaling Technology), Cyclin A (Santa Cruz Biotechnology, Inc.), Cyclin B (Santa Cruz Biotechnology, Inc.), CDK1 (Santa Cruz Biotechnology, Inc.), β-actin (Santa Cruz Biotechnology, Inc.), and GAPDH (Santa Cruz Biotechnology, Inc.).

Techniques: Expressing, Western Blot, Control

Expression and prognostic analysis of E2F2 in SOCs. (A) Expression of E2F2 was significantly upregulated in SOC tissues. (B) E2F2 expression was increased in the grade 2/3 group compared with the grade 1 group. (C–H) SOC patients with high expression of E2F2 had poor OS and PFS. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Expression and prognostic analysis of E2F2 in SOCs. (A) Expression of E2F2 was significantly upregulated in SOC tissues. (B) E2F2 expression was increased in the grade 2/3 group compared with the grade 1 group. (C–H) SOC patients with high expression of E2F2 had poor OS and PFS. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Expressing

Mutation landscape of E2F2 in SOCs. (A) Mutation status of E2F2 in SOCs. (B) Location of E2F2 mutations and associated altered proteins in SOCs. Correlation between E2F2 expression and single-nucleotide variation (C) as well as copy number variation (D) . *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Mutation landscape of E2F2 in SOCs. (A) Mutation status of E2F2 in SOCs. (B) Location of E2F2 mutations and associated altered proteins in SOCs. Correlation between E2F2 expression and single-nucleotide variation (C) as well as copy number variation (D) . *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Mutagenesis, Expressing

Co-expressed genes of E2F2 in SOCs. (A) Top six genes most positively or negatively correlated with E2F2 in SOCs. Top five genes most positively correlated with E2F2: ORC1 (B) , RAD54L (C) , CCNF (D) , NCAPH (E) , and HASPIN (F) . *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Co-expressed genes of E2F2 in SOCs. (A) Top six genes most positively or negatively correlated with E2F2 in SOCs. Top five genes most positively correlated with E2F2: ORC1 (B) , RAD54L (C) , CCNF (D) , NCAPH (E) , and HASPIN (F) . *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques:

Functional and pathway enrichment analysis of E2F2-related genes. (A) 808 differentially expressed genes (DEGs) and expression heat maps based on E2F2 expression. (B) GO functional enrichment analysis of relevant biological process, cellular components, and molecular functions of interacting genes of E2F2. (C) KEGG pathway analysis of relevant signal pathways of interacting genes of E2F2. (D) GSEA of relevant biological process of DEGs. DEGs, differentially expressed genes; GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, Gene set enrichment analysis.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Functional and pathway enrichment analysis of E2F2-related genes. (A) 808 differentially expressed genes (DEGs) and expression heat maps based on E2F2 expression. (B) GO functional enrichment analysis of relevant biological process, cellular components, and molecular functions of interacting genes of E2F2. (C) KEGG pathway analysis of relevant signal pathways of interacting genes of E2F2. (D) GSEA of relevant biological process of DEGs. DEGs, differentially expressed genes; GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, Gene set enrichment analysis.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Functional Assay, Expressing

Correlation of E2F2 with tumor microenvironment and immune function. (A,B) Correlation of E2F2 expression with immune cells. (C) SOC patients with low E2F2 expression had high immuneScore. (D) Correlation between E2F2 and tumor mutation burden in SOCs. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Correlation of E2F2 with tumor microenvironment and immune function. (A,B) Correlation of E2F2 expression with immune cells. (C) SOC patients with low E2F2 expression had high immuneScore. (D) Correlation between E2F2 and tumor mutation burden in SOCs. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Expressing, Mutagenesis

Treatment strategy for SOCs based on E2F2. (A) Correlation between E2F2 expression and immune checkpoints. (B) SOC patients with low E2F2 expression responded better in anti-CTLA4 treatment. (C) No significant difference in anti-PD1 treatment between patients with low E2F2 expression and patients with high E2F2 expression of SOC. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Treatment strategy for SOCs based on E2F2. (A) Correlation between E2F2 expression and immune checkpoints. (B) SOC patients with low E2F2 expression responded better in anti-CTLA4 treatment. (C) No significant difference in anti-PD1 treatment between patients with low E2F2 expression and patients with high E2F2 expression of SOC. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Expressing

Correlation between E2F2 expression and common drugs for chemotherapy and targeted therapy. Average of IC 50 score of crizotinib (A) , entospletinib (B) , erlotinib (C) , ruxolitinib (D) , carmustine (E) , cyclophosphamide (F) , fulvestrant (G) , and vinblastine (H) in the high E2F2 expression group decreased versus that in the low E2F2 expression group. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Correlation between E2F2 expression and common drugs for chemotherapy and targeted therapy. Average of IC 50 score of crizotinib (A) , entospletinib (B) , erlotinib (C) , ruxolitinib (D) , carmustine (E) , cyclophosphamide (F) , fulvestrant (G) , and vinblastine (H) in the high E2F2 expression group decreased versus that in the low E2F2 expression group. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Expressing

Experimental validation of E2F2 function in SOC. (A) Detection of E2F2 mRNA levels in five ovarian cancer cell lines (Hey, HeyA8, OVCA429, SKOV3, and A2780) by RT-qPCR. GAPDH was used to normalize the expression of E2F2. (B) RT-qPCR analysis showing the efficiency of E2F2 overexpression in HeyA8 cells and E2F2 knockdown in A2780 cells. (C) Western blot analysis demonstrating the efficacy of E2F2 overexpression in HeyA8 cells and E2F2 knockdown in A2780 cells. (D,E) RAD54L, CCNF, NCAPH, ORC1, and HASPIN mRNA expression of E2F2-overexpression HeyA8 or E2F2-knocking down A2780 and the respective negative control cell. (F–M) Paclitaxel or cisplatin IC 50 and viability comparison between E2F2-overexpression HeyA8 or E2F2-knocking down A2780 and respective negative control cell. (N,P) Representative images analysis of Transwell migration/invasion assays using E2F2-overexpression HEY A8 cells and E2F2-knockdown A2780 cells, Scale bars = 50 μm. (O,Q) Quantitative analysis of migration and invasion cells (P < 0.05). Error bars = 95% CIs. All dates presented as mean ± SD, n = 3 biologically independent repeats.*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not statistically significant.

Journal: Frontiers in Molecular Biosciences

Article Title: Integrated analysis and experimental validation of E2F2 as a potential prognostic biomarker and its oncogenic roles in serous ovarian cancer

doi: 10.3389/fmolb.2025.1661558

Figure Lengend Snippet: Experimental validation of E2F2 function in SOC. (A) Detection of E2F2 mRNA levels in five ovarian cancer cell lines (Hey, HeyA8, OVCA429, SKOV3, and A2780) by RT-qPCR. GAPDH was used to normalize the expression of E2F2. (B) RT-qPCR analysis showing the efficiency of E2F2 overexpression in HeyA8 cells and E2F2 knockdown in A2780 cells. (C) Western blot analysis demonstrating the efficacy of E2F2 overexpression in HeyA8 cells and E2F2 knockdown in A2780 cells. (D,E) RAD54L, CCNF, NCAPH, ORC1, and HASPIN mRNA expression of E2F2-overexpression HeyA8 or E2F2-knocking down A2780 and the respective negative control cell. (F–M) Paclitaxel or cisplatin IC 50 and viability comparison between E2F2-overexpression HeyA8 or E2F2-knocking down A2780 and respective negative control cell. (N,P) Representative images analysis of Transwell migration/invasion assays using E2F2-overexpression HEY A8 cells and E2F2-knockdown A2780 cells, Scale bars = 50 μm. (O,Q) Quantitative analysis of migration and invasion cells (P < 0.05). Error bars = 95% CIs. All dates presented as mean ± SD, n = 3 biologically independent repeats.*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not statistically significant.

Article Snippet: Lentiviral vectors for E2F2 overexpression and their corresponding negative controls were purchased from Shanghai Genechem Company (Shanghai, China).

Techniques: Biomarker Discovery, Quantitative RT-PCR, Expressing, Over Expression, Knockdown, Western Blot, Negative Control, Comparison, Migration

a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control

a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Journal: Nature

Article Title: Targeting G1–S-checkpoint-compromised cancers with cyclin A/B RxL inhibitors

doi: 10.1038/s41586-025-09433-w

Figure Lengend Snippet: a , Representative γH2AX and DAPI confocal microscopic images of NCI-H1048 cells treated with the cyclin A/B RxL inhibitor (CIRc-004) at 20 nM or DMSO for 72 h. Magnification = 63x, scale bar = 10 µm. b, c , Immunoblot analysis for phospho-RPA2 S33 ( b ) and phospho-KAP1 ( c ) of NCI-H1048 treated with CIRc-004 at indicated concentrations for 24 h. d , Immunoblot analysis of NCI-H1048 cells infected with indicated sgRNAs and then treated CIRc-004 at 20 nM or DMSO for 72 h. e , Immunoblot analysis of histone lysates from NCI-H1048 cells treated with the selective cyclin A RxL inhibitor (CIRc-018), the selective cyclin B RxL inhibitor (CIRc-019), the cyclin A/B RxL inhibitor (CIRc-004), or DMSO (vehicle) for 72 h. f , E2F3 Immunoblot analysis after IP of endogenous cyclin A in NCI-H1048 cells treated with CIRc-004 (300 nM), CIRc-005 (inactive enantiomer of CIRc-004, I.E), cyclin A RxL inhibitor (CIRc-018) or DMSO for 2 h. E2F3 band intensity is normalized to cyclin A shown at the bottom. n = 2 biological independent experiments. g , Immunoblot analysis of NCI-H82 cells infected with a doxycycline (DOX) inducible E2F1 sgRNA-resistant cDNA and then superinfected with an sgRNA targeted endogenous E2F1 grown in the presence or absence of DOX for 24 h. h , Dose response assays of NCI-H82 cells from g grown in the presence or absence of DOX for 24 h and then treated with increasing concentrations of CIRc-004 for 6 days. Data are mean +/− SD and arrows indicates DMSO-treated sample which was used for normalization. i,k , Immunoblot analysis of NCI-H1048 ( i ) and Jurkat ( k ) cells infected with a doxycycline (DOX) inducible E2F1, E2F2 or E2F3 cDNA grown in the presence or absence of DOX for 24 h. j , l , Quantitation of average half-maximal effective concentration (EC50) without (light blue) or with (dark blue) DOX of NCI-H1048 ( j ) or Jurkat cells ( l ) from i, k expressing DOX inducible E2F1, E2F2, E2F3 treated with CIRc-004 at increasing concentrations for 3 days ( j) or 6 days ( l) . For a-e , h, j, l , representative immunoblots from 3 independent experiments are shown. For histone blots in d , e , total histone H3 run as sample processing control on separate gel.

Article Snippet: To make the DOX-on pTripz neo E2F1, E2F2 or E2F3 construct, pDONR223 E2F1 (W. G. Kaelin’s laboratory), pCMVHA E2F2 (Addgene, 24226) and pCMV Tag2B E2F3 (Addgene, 202522) were used as templates for overhang PCR to introduce the attB1 and attB2 sites onto the 5′ and 3′ ends of E2F1 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCCTTGGCCGGGGCCCCTGCG; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATCCAGGGGGGTGAGGTCCCC-3′), E2F2 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGCTGCAAGGGCCCCGGGCCTTG-3′; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCAACAGGTCCCCAAGGTC-3′) and E2F3 (sense primer, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGAGAAAGGGAATCCAGCCCGCT; and antisense primer, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTACTACACATGAAGTCTTCCACCAG-3′).

Techniques: Western Blot, Infection, Quantitation Assay, Concentration Assay, Expressing, Control